Genetic Structure of Protein S

[James]

"What is the genetic structure of Protein S?"

[James]

http://www.ncbi.nlm.nih.gov/entrez/viewer....?val=AAA60357.1

1: AAA60357. S protein...[gi:190549]

LOCUS AAA60357 676 aa linear PRI 10-JAN-1995

DEFINITION S protein.

ACCESSION AAA60357

VERSION AAA60357.1 GI:190549

DBSOURCE locus HUMPS01 accession M57840.1

locus HUMPS02 accession M57841.1

locus HUMPS03 accession M57842.1

locus HUMPS04 accession M57843.1

locus HUMPS05 accession M57844.1

locus HUMPS06 accession M57845.1

locus HUMPS07 accession M57846.1

locus HUMPS08 accession M57847.1

locus HUMPS09 accession M57848.1

locus HUMPS10 accession M57849.1

locus HUMPS11 accession M57850.1

locus HUMPS12 accession M57851.1

locus HUMPS13 accession M57852.1

locus HUMPS14 accession M57853.1

KEYWORDS .

SOURCE Homo sapiens (human)

ORGANISM Homo sapiens

Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;

Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo.

REFERENCE 1 (residues 1 to 676)

AUTHORS Schmidel,D.K., Tatro,A.V., Phelps,L.G., Tomczak,J.A. and Long,G.L.

TITLE Organization of the human protein S genes

JOURNAL Biochemistry 29 (34), 7845-7852 (1990)

MEDLINE 91084444

PUBMED 2148110

COMMENT Method: conceptual translation.

FEATURES Location/Qualifiers

source 1..676

/organism="Homo sapiens"

/db_xref="taxon:9606"

/map="3p11-q11.2"

/tissue_type="liver"

Protein 1..676

/product="S protein"

sig_peptide 1..41

/gene="PS-alpha"

mat_peptide 42..676

/gene="PS-alpha"

/product="S protein"

CDS 1..676

/gene="PROS1"

/coded_by="join(M57840.1:837..912,M57841.1:135..292,

M57842.1:158..182,M57843.1:176..262,M57844.1:104..226,

M57844.1:332..463,M57845.1:166..291,M57846.1:144..265,

M57847.1:492..607,M57848.1:169..358,M57849.1:183..350,

M57850.1:96..264,M57851.1:168..319,M57852.1:76..301,

M57853.1:147..307)"

/db_xref="GDB:G00-120-721"

ORIGIN

1 mrvlggrcga llaclllvlp vseanflskq qasqvlvrkr ranslleetk qgnlerecie

61 elcnkeeare vfendpetdy fypkylvclr sfqtglftaa rqstnaypdl rscvnaipdq

121 csplpcnedg ymsckdgkas ftctckpgwq gekcefdine ckdpsningg csqicdntpg

181 syhcsckngf vmlsnkkdck dvdecslkps icgtavckni pgdfececpe gyrynlksks

241 cedidecsen mcaqlcvnyp ggytcycdgk kgfklaqdqk scevvsvclp lnldtkyell

301 ylaeqfagvv lylkfrlpei srfsaefdfr tydsegvily aesidhsawl lialrggkie

361 vqlknehtsk ittggdvinn glwnmvsvee lehsisikia keavmdinkp gplfkpengl

421 letkvyfagf prkveselik pinprldgci rswnlmkqga sgikeiiqek qnkhclvtve

481 kgsyypgsgi aqfhidynnv ssaegwhvnv tlnirpstgt gvmlalvsgn ntvpfavslv

541 dstseksqdi llsventviy riqalslcsd qqshlefrvn rnnlelstpl kietishedl

601 qrqlavldka mkakvatylg glpdvpfsat pvnafyngcm evningvqld ldeaiskhnd

661 irahscpsvw kktkns

//

Revised: August 5, 2002.

[James]

http://archive.uwcm.ac.uk/uwcm/mg/int_exon/120721.txt

; GENE SYMBOL / OMIM NUMBER / GDB NUMBER

; PROS1 / 176880 / 120721

; S Protein-a (PS-a) gene

; Protein S deficiency

; The PROS1 gene has 15 exons / all exons are translated

; Based on Genbank Accession Numbers: M57840 > M57853

;

5UTR E0001 cgaggctcgctgggtcgctggcgccgcc/GCGCAGCACGGCTCAGACCGAGGCGC

; CTGCCGGCGCCTCCGCGCGCTTCGAA[ATG]AGGGTCCTGGGTGGGCGCTG

E0001 I0001 GCTTCCCGTCTCAGAGGCAAAC[Tgtgagtaatcaatagcgtctcttctccct

I0001 E0002 attcatataaactgattgtttccttcagTT]TTGTCAAAGCAACAGGCTTCA

E0002 I0002 TCTTTGAAAATGACCCGGAAACGgtaagcatttatggaaactatcaagttc

I0002 E0003 I0003

agatatgttttctttttcttctttctagGATTATTTTTATCCAAAATACTTA[Ggtaagttcaaaacatctcaattatat

aa

; [ This exon contains ONLY 25 nucleotides ]

I0003 E0004 agaagattatgtttgtttttattttcagTT]TGTCTTCGCTCTTTTCAAACT

E0004 I0004 TGACCTAAGAAGCTGTGTCAAT[Ggtaagcacttctaccatcaattg(a)6caaaac

I0004 E0005 gagat(a)8taaatagatgtctatttccttcagCC]ATTCCAGACCAGTGTAGTCCT

E0005 I0005 GCAAGGAGAAAAGTGTGAATTT[Ggtacgtataataacccccg©6agctcatcag

I0005 E0006 tactttaaaaataattta(t)7cctgttttagAC]ATAAATGAATGCAAAGATCCCT

E0006 I0006 TTCAAATAAGAAAGATTGTAAA[Ggtaagagcaggatggtagaattaaaaca

I0006 E0007 gaaaaatg(t)6 aatatagtgattttatttatagAT]GTGGATGAATGCTCTTTGAAG

E0007 I0007 TCTCAAATCAAAGTCTTGTGAA[Ggtaggatgatggtggtatcattactgatc

I0007 E0008 attaaagtttgtgtgcgtgtg(t)8acctcagAT]ATAGATGAATGCTCTGAGAAC

E0008 I0008 GCCCAAGATCAGAAGAGTTGTGAGgtaaacattttacaatgcttaacttctc

I0008 E0009 gttgtttatttggtttcttttattccagGTTGTTTCAGTGTGCCTTCCCTTG

E0009 I0009 ATTTCGTTTGCCAGAAATCAGC[AGgtgaggaaccaataccaatgataatttc

I0009 E0010 taaggatctctctttgtccattgtttagA]TTTTCAGCAGAATTTGATTTCCG

E0010 I0010 ATTAATAATGGTCTATGGAATATGgtacgtttgcagatttcatcaatatcttc

I0010 E0011 tatttggtaatttttctttttaattgtagGTGTCTGTGGAAGAATTAGAACA

E0011 I0011 TGGAAAGTGAACTCATTAAACCGgtaatgatccaagcttgtatcattcatca

I0011 E0012 ctccttgacttgtattttaatttgttagATTAACCCTCGTCTAGATGGATG

E0012 I0012 TGCTCAATTTCACATAGATTAT[Agtaagtgattttccatttatctctattttc

I0012 E0013 catgcttctgtttcattattttaaatagAT]AATGTATCCAGTGCTGAGGGT

E0013 I0013 ACTCCACCTCTGAAAAATCACAGgtaacttaactctaaacctatataagcct

I0013 E0014 tatattgaatctttgctctgctcttcagGATATTCTGTTATCTGTTGAAAAT

E0014 I0014 CACATACCTGGGTGGCCTTCCA[Ggtatctgcttactttttcttcagtttta

I0014 E0015 ctaatattctaatattttccttttacagAT]GTTCCATTCAGTGCCACACCA

E0015 3UTR GAAAAAGACAAAGAATTCT[TAA]GGCATCTTTTCTCTGCTTATAAT

[James]

http://www.bloodjournal.org/cgi/content/fu...ey=9MbnT/FxZrdB.

Blood, Vol. 95 No. 6 (March 15), 2000: pp. 1935-1941

CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS

Genetic analysis, phenotypic diagnosis, and risk of venous thrombosis in families with inherited deficiencies of protein S

Michael Makris, Michael Leach, Nick J. Beauchamp, Martina E. Daly, Peter C. Cooper, Kingsley K. Hampton, Pauline Bayliss, Ian R. Peake, George J. Miller, and F. Eric Preston

From the Division of Molecular and Genetic Medicine, University of Sheffield, Royal Hallamshire Hospital, Sheffield, United Kingdom; and MRC Epidemiology and Medical Care Unit, Wolfson Institute of Preventive Medicine, London, United Kingdom.

Human DNA contains 2?PS genes: the active PROS1 gene and a closely linked pseudogene (PROS2), which shows 96.5% homologyto exons 2?to 15?of the PROS1 gene.9-11 The PROS1 gene comprises 15?exons and 14?introns spanning some 80?kb of genomic DNA.12 Despite the complexity of the PROS1 gene, the development of procedures permitting selective amplification of PROS1 gene sequences and the availability of PROS1 mRNA in platelets have facilitated investigation of the molecular basis of PS deficiency and the identification of PROS1 gene defects, which have recently been compiled into a PROS1 mutation database.13 Three PROS1 gene dimorphisms have been reported: an exonic A/G dimorphism in codon 626,14,15 a C/T dimorphism in nucleotide 54?in intron K (PIPS1), and a C/A dimorphism 520?bp downstream of the stop codon in the 3'UTR (PEPS2).16 Another, rare, T/C dimorphism in codon 460?causes substitution of S460 by P (single-letter amino acid code) and results in a circulating PS molecule with a lower molecular weight than normal. This Heerlen PS is thought to have a higher affinity for C4bBP than normal, causing an abnormal distribution of mutated and normal PS on C4bBP and a selective reduction in free PS.17 Although the Heerlen allele was originally demonstrated to occur at similar frequencies among thrombophilia patients and healthy blood donors,18 2?separate studies found that it occurred more often among PS-deficient patients, particularly those with type III deficiency.17,19

References

9. Ploos van Amstel JK, van der Zanden AL, Bakker E, Reitsma PH, Bertina RM. Two genes homologous with human protein S cDNA are located on chromosome 3. Thromb Haemost. 1987;58:982[Medline].

10. Edenbrandt CM, Lundwall A, Wydro R, Stenflo J. Molecular analysis of the gene for vitamin K dependent protein S and its pseudogene: cloning and partial gene organization. Biochemistry. 1990;29:7861[Medline].

11. Watkins P, Eddy R, Fukushima Y, et al. The gene for protein S maps near the centromere of human chromosome 3. Blood. 1988;71:238[Abstract].

12. Schmidel DK, Tatro AV, Tomczak JA, Long GL. Organization of the human protein S genes. Biochemistry. 1990;29:7845[Medline].

13. Gandrille S, Borgel D, Ireland H, et al. Protein S deficiency: a database of mutations. Thromb Haemost. 1997;77:1201[Medline].

14. Diepstraten CM, Ploos van Amstel HK, Reitsma PH, Bertina RA. A CCA/CCG neutral dimorphism in the codon for Pro626 of the human protein S gene Ps(PROS1). Nucleic Acids Res. 1991;19:5091[Medline].

15. Sacchi E, Pinotti M, Marchetti G, et al. Protein S mRNA in patients with protein S deficiency. Thromb Haemost.1995;73:746[Medline].

16. Mustafa S, Pabinger I, Mannhalter C. Two new frequent dimorphisms in the protein S (PROS1) gene. Thromb Haemost.1996;76:393[Medline].

17. Duchemin J, Gandrille S, Borgel D, et al. The Ser460 to Pro substitution of the protein S (PROS1) gene is a frequent mutation associated with free protein S (type IIa) deficiency. Blood. 1995;86:3436[Abstract/Free Full?Text].

18. Bertina RM, Ploos van Amstel HK, van Wijngaaden A, et al. Heerlen polymorphism of protein S, an immunologic polymorphism due to dimorphism of residue 460. Blood. 1990;76:538[Abstract].

19. Espinosa-Parrilla Y, Morell M, Souto JC, et al. Absence of linkage between type III protein S deficiency and PROS1 and C4BP genes in families carrying protein S Heerlen allele. Blood. 1997;89:2799[Abstract/Free Full?Text].

[James]

Note: this email was received in reply to a question about the suitability of Protein S in computer folding simulations.

From: Blue Gene <bluegene@us.ibm.com>

Date: Mon Feb 10, 2003 4:34:49 pm Europe/London

Subject: Re: Protein S Deficiency

From the information that I have seen, this protein is extremely large (676

residues) and is therefore unlikely to be practical for folding simulations

in explicit solvent even when the initial Blue Gene hardware becomes

available. Our work on folding mechanisms currently focuses on much

smaller systems (peptides with under 20 residues). You also might want to

check the information available from our web site at

http://www.research.ibm.com/bluegene